The NFκB(p50)₂ protein is a Kappa-B transcription factor consisting of two p50 DNA-binding subunits. Each subunit binds DNA via two beta-barrel structures. The p50 homodimer plays many physiological roles, including regulation of inflammatory responses and is involved in cellular apoptosis. In this structure, NFκB(p50)₂ is bound to two single stranded high affinity RNA Aptamers.

Protein-RNA Aptamer Complex

Backbone of full structure (RNA in blue)

Complex.  NFkB(p50)₂ spacefill

p50 Subunits

p50 Subunits only

p50 Subunits backbone

p50 secondary structure

Complex.  RNA strands spacefill (5'CAUACUUGAAACUGUAAGGUUGGCGUAUG3')

RNA strand: line drawing. Notice the alignment of the bases allowing intrarstrand base-pairing on the bound RNA

p50-RNA Complex

p50 subunit

p50 Subunit Binding Site

Spacefill Model - Notice the appears of a structure similar to the major/minor groves in the aptamer in its folded, bound state

Protein(cartoon) interacting with RNA (H bonds in  blue)