|
NFkB(P50)2 Complexed To
a High- Affinity RNA Aptamer |
The NFkB(p50)2 protein is a Kappa-B transcription factor consisting of two p50 DNA-binding subunits. Each subunit binds DNA via two beta-barrel structures. The p50 homodimer plays many physiological roles, including regulation of inflammatory responses and is involved in cellular apoptosis. In this structure,
NFkB(p50)2 is bound to two
single stranded high affinity RNA Aptamers.
Protein-RNA Aptamer Complex
Backbone of full structure (RNA in
blue)
Complex. NFkB(p50)2
spacefill
p50 Subunits
p50 Subunits only
p50 Subunits backbone
p50 secondary structure
Complex. RNA
strands spacefill (5'CAUACUUGAAACUGUAAGGUUGGCGUAUG3')
RNA strand: line drawing. Notice
the alignment of the bases allowing intrarstrand base-pairing on the
bound RNA
p50-RNA Complex
p50 subunit
p50 Subunit Binding Site
Spacefill Model - Notice the appears of a structure similar to the major/minor
groves in the aptamer in its folded, bound state
Protein(cartoon)
interacting with RNA (H bonds in blue)
Cartoon and Wireframe
|