NFκB(P50)₂ Complexed To a High- Affinity RNA Aptamer

Java version

HTML 5 version (does not require Java; downloads and moves slowly)

The NFκB(p50)₂ protein is a Kappa-B transcription factor consisting of two p50 DNA-binding subunits. Each subunit binds DNA via two beta-barrel structures. The p50 homodimer plays many physiological roles, including regulation of inflammatory responses and is involved in cellular apoptosis. In this structure, NFκB(p50)₂ is bound to two single stranded high affinity RNA Aptamers.

For more information see Biochemistry Online: Chapter 5E - New Methods in Drug Development

---

Protein-RNA Aptamer Complex
Backbone of full structure (RNA in blue)
Complex. NFkB(p50)₂ spacefill
p50 Subunits
p50 Subunits only
p50 Subunits backbone
p50 secondary structure
Complex. RNA strands spacefill (5'CAUACUUGAAACUGUAAGGUUGGCGUAUG3')
RNA strand: line drawing. Notice the alignment of the bases allowing intrarstrand base-pairing on the bound RNA
p50-RNA Complex
p50 subunit
p50 Subunit Binding Site
Spacefill Model - Notice the appears of a structure similar to the major/minor groves in the aptamer in its folded, bound state
Protein(cartoon) interacting with RNA (H bonds in blue)
Cartoon and Wireframe